Bepirovirsen (sodium)
CAS No. : 2563929-84-8
(Synonyms: ISIS 505358 (sodium))
| Size | Price | Stock |
|---|---|---|
| 1mg | $210 | In-stock |
| 5mg | $665 | In-stock |
| 10mg | $1120 | In-stock |
| 50 mg | Get quote | |
| 100 mg | Get quote | |
| We match the lowest price on market. | ||
We offer a substantial discount on larger orders, please inquire via [email protected]
or Fax: (86)21-58955996
Inquiry for price and availability only. Please place your order via our email or fax.
| Cat. No. : | HY-147217A |
| M.Wt: | 1000.00 |
| Formula: | C230H290N88Na19O115P19S19 |
| Purity: | >98 % |
| Solubility: | 10 mM in H2O;10 mM in H2O |
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC)[1][2][3].
In Vitro: Bepirovirsen sodium (16-250 nM, 96 h) reduces levels of HBV RNA transcripts in HBV-expressing HepG cells[3].
In Vivo: Bepirovirsen sodium (22 and 50 mg/kg, s.c., twice weekly for week 1 and once weekly for weeks 2-4) reduces hepatic RNA transcripts, subsequent production of HBV DNA, and associated HBV serum antigens in HBV-transgenic mice[3].
Lorem ipsum dolor sit amet, consectetur adipisicing elit. Autem earum hic iste maiores, nam neque rem suscipit. Adipisci consequatur error exercitationem fugit ipsam optio qui, quibusdam repellendus sed vero! Debitis.
Inquiry Information- Product Name:
- Bepirovirsen (sodium)
- Cat. No.:
- HY-147217A
- Quantity:
Your information is safe with us.